-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepLexA
-
Backbone manufacturersee "author's map". Not the same as Clontech's pLexA.
- Backbone size (bp) 5700
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- LexA DNA Binding Domain (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Yeast two-hybrid DNA-binding domain vector, containing the MCS illustrated in the author's map. Use for traditional cloning for a target cDNA sequence for a yeast two-hybrid screen.
This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLexA was a gift from Guy Caldwell (Addgene plasmid # 11342 ; http://n2t.net/addgene:11342 ; RRID:Addgene_11342)
Map uploaded by the depositor.
