Skip to main content
Addgene

pLexAgtwy
(Plasmid #11345)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11345 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLexA
  • Backbone manufacturer
    see map of pLexA in "author's map"
  • Backbone size w/o insert (bp) 5700
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    This vector is propagated in E. coli strain DB3.1, due to the requirement to circumvent the lethality of the inherent ccdB gene until an insert is recombined into the Gateway cassette.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gateway cassette

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site SmaI (unknown if destroyed)
  • 3′ cloning site SmaI (unknown if destroyed)
  • 5′ sequencing primer LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway-modified yeast two-hybrid DNA-binding domain vector. Use this vector for Gateway cloning of a cDNA to be used as the bait in a yeast two-hybrid screen. This vector was modified from plasmid pLexA by placing a Gateway acceptor cassette in the SmaI site of pLexA. To facilitate subcloning of a given DNA insert into this plasmid, Gateway recombinational attachment sites should be incorporated into primers used for amplificiation, as outlined in the Invitrogen Gateway manual. Gateway recombinational cassettes should be added to primers as outlined in the Invitrogen Gateway manual. (Gateway is a registered trademark of Invitrogen Corporation). Please note that the "author's map" is the map of the original pLexA vector upon which pLexAgtwy is derived - it is not a map of pLexAgtwy.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLexAgtwy was a gift from Guy Caldwell (Addgene plasmid # 11345 ; http://n2t.net/addgene:11345 ; RRID:Addgene_11345)