pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR
(Plasmid #113162)

• Purpose: A donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9n and a NeoR selectable marker
• Depositing Lab: Brandon Harvey
• Publication: Back et al Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035.

Backbone

• Vector backbone: pZDrRosa26
• Backbone manufacturer: Sigma
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 12714
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpCas9
• Alt name: S. pyogenes Cas9 nuclease
• Alt name: Cas9
• Species: Synthetic
• Insert Size (bp): 4200
• Mutation: D10A
• Promoter: CAG
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TCTCGTTGCTGAAGATCTCTTGCAG
• 3′ sequencing primer: CAGGCCGAGAATATCATCCACC

Resource Information

• Supplemental Documents:
  • pOTTC1076 - pZDrRosa26 CAG flox(stop) FLAG-NLS-Cas9n-NLS FRT(NeoR) for Addgene.ape.ape
• A portion of this plasmid was derived from a plasmid made by: The insert was amplified from PX461, addgene 48140

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Addgene NGS unable to fully resolve the CAG promoter sequence. Please refer to the depositor's provided sequence for that section of the plasmid.