LSL-Cas9-Rosa26TV
(Plasmid #61408)

• Purpose: Cre-dependent Cas9 expression plasmid and targeting vector for the mouse Rosa26 locus. Cas9 expression is Cre-dependent and the targeting vector has positive (Neo) and negative (DTA) selection.
• Depositing Lab: Feng Zhang
• Publication: Platt et al Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.

Backbone

• Vector backbone: Ai9
• Backbone size w/o insert (bp): 14500
• Total vector size (bp): 20541
• Vector type: Mammalian Expression, Mouse Targeting, Cre/Lox, CRISPR
• Selectable markers: Neomycin (select with G418) ; DTA

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Please note that this plasmid is prone to recombination. We recommend screening 3-5 colonies to ensure the full plasmid is intact.
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Synthetic; streptococcus pyogenes
• Insert Size (bp): 4101
• Mutation: human codon optimized
• Promoter: CAG
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • P2A (C terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atgtctggatccccatcaagc
• 3′ sequencing primer: CTGCTTGTCGGCCATGATATAG

Gene/Insert 2

• Gene/Insert name: EGFP
• Insert Size (bp): 714
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGTCTCAGCTGGGAGGCGAC
• 3′ sequencing primer: gtatccacatagcgtaaaaggagc

Resource Information

• Supplemental Documents:
  • Plasmid sequence
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry