pKLV2-EF1adCas9VP64T2ABsd-W
(Plasmid #112919)

• Purpose: Lentiviral vector expressing Lentiviral vector expressing Lentiviral vector expressing dCas9VP64 under the control of the long human EF1a promoter
• Depositing Lab: Kosuke Yusa
• Publication: Chong et al Genome Biol. 2018 Nov 26;19(1):205. doi: 10.1186/s13059-018-1581-3.

Backbone

• Vector backbone: pKLV2-EF1a-W
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 12854
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9VP64-T2A-Blast
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 4872
• Promoter: Human EF1a promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGTAATTCTCCTTGGAATTTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry