pLX-sgRNA-BfuAI-2k
(Plasmid
#112915)
-
Purpose(Empty Backbone) Empty sgRNA expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepLX-sgRNA
- Backbone size (bp) 7500
-
Modifications to backboneModified to enable sgRNA insertion after BfuAI digestion. Also modified to include a 2kb stuffer sequence for easier gel purification of the fully digested vector.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter U6
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer cgggtttattacagggacagcag
- 3′ sequencing primer taccagtcaatctttcacaaattttgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX-sgRNA-BfuAI-2k was a gift from Ren-Jang Lin (Addgene plasmid # 112915 ; http://n2t.net/addgene:112915 ; RRID:Addgene_112915) -
For your References section:
MicroRNA-focused CRISPR-Cas9 Library Screen Reveals Fitness-Associated miRNAs. Kurata JS, Lin RJ. RNA. 2018 May 2. pii: rna.066282.118. doi: 10.1261/rna.066282.118. 10.1261/rna.066282.118 PubMed 29720387
