-
PurposeGeneral donor vector with EGFP coding sequence flanking by restriction sites for generating knock-in donor
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112848 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBluescript SK (-)
- Total vector size (bp) 3984
-
Vector typeUnspecified ; general donor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
- Promoter No
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACACAGGAAACAGCTATGAC
- 3′ sequencing primer CGCAACTGTTGGGAAGGGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EasyFusion eGFP was a gift from Janet Rossant (Addgene plasmid # 112848 ; http://n2t.net/addgene:112848 ; RRID:Addgene_112848) -
For your References section:
Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212
Map uploaded by the depositor.
