-
PurposeGeneral donor vector with Halo-mAID coding sequence flanking by restriction sites for generating knock-in donor for Auxin inducible degradation of Halo tagged endogenous protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112852 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript SK (-)
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHalo-mAID
-
Alt nameHaloTag, mini auxin inducible degron
-
SpeciesSynthetic
- Promoter No
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACACAGGAAACAGCTATGAC
- 3′ sequencing primer CGCAACTGTTGGGAAGGGC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EasyFusion Halo-mAID was a gift from Janet Rossant (Addgene plasmid # 112852 ; http://n2t.net/addgene:112852 ; RRID:Addgene_112852) -
For your References section:
Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212