pZac2.1 GfaABC1D ChR2(H134R) mCherry SV40
(Plasmid
#112496)
-
PurposeExpresses channel rhodopsin in astrocytes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepZac2.1
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 7033
-
Modifications to backboneGfaABC1D promoter
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChR2(H134R)
-
Alt nameChannel Rhodopsin
-
SpeciesSynthetic
-
Insert Size (bp)1747
-
MutationH134R
- Promoter GfaABC1D
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTGAGCAGGGGGCTTGCATT
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene (#26975), Karl Deisseroth
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZac2.1 GfaABC1D ChR2(H134R) mCherry SV40 was a gift from Baljit Khakh (Addgene plasmid # 112496 ; http://n2t.net/addgene:112496 ; RRID:Addgene_112496) -
For your References section:
Transient, Consequential Increases in Extracellular Potassium Ions Accompany Channelrhodopsin2 Excitation. Octeau JC, Gangwani MR, Allam SL, Tran D, Huang S, Hoang-Trong TM, Golshani P, Rumbell TH, Kozloski JR, Khakh BS. Cell Rep. 2019 May 21;27(8):2249-2261.e7. doi: 10.1016/j.celrep.2019.04.078. 10.1016/j.celrep.2019.04.078 PubMed 31116972