pZac2.1 GfaABC1D ChR2(H134R) mCherry SV40
(Plasmid #112496)

• Purpose: Expresses channel rhodopsin in astrocytes
• Depositing Lab: Baljit Khakh
• Publication: Octeau et al Cell Rep. 2019 May 21;27(8):2249-2261.e7. doi: 10.1016/j.celrep.2019.04.078.

Backbone

• Vector backbone: pZac2.1
• Backbone size w/o insert (bp): 5300
• Total vector size (bp): 7033
• Modifications to backbone: GfaABC1D promoter
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChR2(H134R)
• Alt name: Channel Rhodopsin
• Species: Synthetic
• Insert Size (bp): 1747
• Mutation: H134R
• Promoter: GfaABC1D
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTGAGCAGGGGGCTTGCATT
• 3′ sequencing primer: GTGGTTTGTCCAAACTCATC

Resource Information

• Supplemental Documents:
  • pZac2.1 gfaABC1D hChR2 H134R mcherry SV40.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene (#26975), Karl Deisseroth
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry