pMSCV_puro_41585
(Plasmid #111631)

• Purpose: Complementation of Dicer_KO mESCs with mutated human DICER isoform
• Depositing Lab: Constance Ciaudo
• Publication: Ciaudo Lab Plasmids (unpublished)

Backbone

• Vector backbone: pMSCV-puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6264
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FLAG-hsDicer (D1320A/D1709A)
• Species: H. sapiens (human)
• Insert Size (bp): 5808
• Mutation: D1320A/D1709A
• Entrez Gene: DICER1 (a.k.a. DCR1, Dicer, Dicer1e, GLOW, HERNA, K12H4.8-LIKE, MNG1, RMSE2, aviD)
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: 5' aattagatctctcgagatggactacaa agacgatgacg 3'
• 3′ sequencing primer: 5' attcgttaacctcgagtcagctattgggaa cctgag 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: FLAG-hsDicer (D1320A/D1709A) from addgene plasmid #41585

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloning performed in 2 steps: 1) PCR amplification of the original plasmid using primers featuring an overhang containing an XhoI restriction site, 2) Digestion of the pMSCV puro plamid by XhoI and ligation of the insert