pCDH-EFIa-Id1-PGK-puro
(Plasmid
#107735)
-
PurposeExpresses Id1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDH-EF1mcs-PGKpuro
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 8650
- Total vector size (bp) 9589
-
Modifications to backboneUsed pCDH-CMV-MCS-copGFP stock plasmid CD511B-1 from System Biosciences. Modified by replacing CMV promoter with EF1 and replacing copGFP with PGKpuro
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameId1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)939
-
GenBank IDNM_010495 NM_010495
-
Entrez GeneT (a.k.a. Bra, D17Mit170, Low, Lr, T1, Tbxt, Tl2, Tl3, cou, me75)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer ATGAAGGTCGCCAGTGGCAGTGCC
- 3′ sequencing primer TCAGCGACACAAGATGCGATCGTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-EFIa-Id1-PGK-puro was a gift from Alexandre Colas (Addgene plasmid # 107735 ; http://n2t.net/addgene:107735 ; RRID:Addgene_107735) -
For your References section:
Id genes are essential for early heart formation. Cunningham TJ, Yu MS, McKeithan WL, Spiering S, Carrette F, Huang CT, Bushway PJ, Tierney M, Albini S, Giacca M, Mano M, Puri PL, Sacco A, Ruiz-Lozano P, Riou JF, Umbhauer M, Duester G, Mercola M, Colas AR. Genes Dev. 2017 Aug 9. pii: gad.300400.117. doi: 10.1101/gad.300400.117. 10.1101/gad.300400.117 PubMed 28794185