pAAV-CAG-dLight1.2
(Plasmid #111069)

• Purpose: To generate Adeno-Associated viruses for expression of dLight1.1 under CAG promoter
• Depositing Lab: Lin Tian
• Publication: Patriarchi et al Science. 2018 Jun 29;360(6396). pii: science.aat4422. doi: 10.1126/science.aat4422. Epub 2018 May 31.

Backbone

• Vector backbone: pAAV-CAG
• Backbone size w/o insert (bp): 5020
• Total vector size (bp): 7063
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dLight1.2
• Species: Synthetic
• Insert Size (bp): 2043
• GenBank ID: MH244550
• Tag / Fusion Protein:
  • Flag tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BaMHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: gctctagagcctctgctaaccatgttc
• 3′ sequencing primer: cgggaagcaatagcatgatacaaaggc

Resource Information

• Supplemental Documents:
  • pAAV-CAG-dLight1.2.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS identified chicken beta-actin promoter, but not the CMV enhancer and chimeric intron often associated with CAG promoters. Please see the associated diagnostic digest for plasmid verification.

Information for AAV1 (Catalog # 111069-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pAAV-CAG-dLight1.2 (#111069). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.2 plasmid DNA.

CAG-driven expression of dLight1.2 dopamine sensor. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.