pCMV-dLight1.3a
(Plasmid
#111055)
-
PurposeExpresses dLight1.3a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP_N1
- Backbone size w/o insert (bp) 3983
- Total vector size (bp) 6029
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedLight1.3a
-
SpeciesSynthetic
-
Insert Size (bp)2046
-
GenBank IDMH244551
- Promoter CAG
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gtggatagcggtttgactcacgggg
- 3′ sequencing primer ggtgtgggaggttttttaaagcaagtaaaacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-dLight1.3a was a gift from Lin Tian (Addgene plasmid # 111055 ; http://n2t.net/addgene:111055 ; RRID:Addgene_111055) -
For your References section:
Ultrafast neuronal imaging of dopamine dynamics with designed genetically encoded sensors. Patriarchi T, Cho JR, Merten K, Howe MW, Marley A, Xiong WH, Folk RW, Broussard GJ, Liang R, Jang MJ, Zhong H, Dombeck D, von Zastrow M, Nimmerjahn A, Gradinaru V, Williams JT, Tian L. Science. 2018 Jun 29;360(6396). pii: science.aat4422. doi: 10.1126/science.aat4422. Epub 2018 May 31. 10.1126/science.aat4422 PubMed 29853555