Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-puro-tetON-shOGDH 2956
(Plasmid #110943)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110943 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone manufacturer
    Dmitri Wiederschain
  • Backbone size w/o insert (bp) 10633
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shOGDH
  • gRNA/shRNA sequence
    GACTACGTGAAGCCAAGACTT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_002541.3
  • Entrez Gene
    OGDH (a.k.a. AKGDH, E1k, E1o, KGD1, OGDC, OGDH-E1, OGDH2, OGDHD)
  • Promoter H1/TO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer ggcagggatattcaccattatcgtttcaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Recombination can be minimized by using NEB Stable E. coli strain grown at 30C to amplify the plasmid DNA. Even so, low recombination rate may still happen and when you eventually amplify the DNA you may need to screen through several colonies and perform diagnostic digests to identify the correct ones.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-puro-tetON-shOGDH 2956 was a gift from William Hahn (Addgene plasmid # 110943 ; http://n2t.net/addgene:110943 ; RRID:Addgene_110943)
  • For your References section:

    PIK3CA mutant tumors depend on oxoglutarate dehydrogenase. Ilic N, Birsoy K, Aguirre AJ, Kory N, Pacold ME, Singh S, Moody SE, DeAngelo JD, Spardy NA, Freinkman E, Weir BA, Tsherniak A, Cowley GS, Root DE, Asara JM, Vazquez F, Widlund HR, Sabatini DM, Hahn WC. Proc Natl Acad Sci U S A. 2017 Apr 25;114(17):E3434-E3443. doi: 10.1073/pnas.1617922114. Epub 2017 Apr 10. 10.1073/pnas.1617922114 PubMed 28396387