lentiCRISPR v2 puro - CRBN (#2)
(Plasmid
#166241)
-
PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPR v2
- Backbone size w/o insert (bp) 14877
- Total vector size (bp) 14895
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRBN
-
gRNA/shRNA sequenceGCAGGACGCTGCGCACAACA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_016302
-
Entrez GeneCRBN (a.k.a. MRT2, MRT2A)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2 puro - CRBN (#2) was a gift from Günter Schneider (Addgene plasmid # 166241 ; http://n2t.net/addgene:166241 ; RRID:Addgene_166241) -
For your References section:
A novel Cereblon E3 ligase modulator with antitumor activity in gastrointestinal cancer. Lier S, Sellmer A, Orben F, Heinzlmeir S, Krauss L, Schneeweis C, Hassan Z, Schneider C, Schafer A, Pongratz H, Engleitner T, Ollinger R, Kuisl A, Bassermann F, Schlag C, Kong B, Dove S, Kuster B, Rad R, Reichert M, Wirth M, Saur D, Mahboobi S, Schneider G. Bioorg Chem. 2021 Nov 20:105505. doi: 10.1016/j.bioorg.2021.105505. 10.1016/j.bioorg.2021.105505 PubMed 34838332