pMS73
(Plasmid #110629)

• Purpose: CRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicating
• Depositing Lab: Regine Kahmann
• Publication: Schuster et al Fungal Genet Biol. 2018 Mar;112:21-30. doi: 10.1016/j.fgb.2016.12.003. Epub 2017 Jan 6.

Backbone

• Vector backbone: pNEBUC
• Backbone manufacturer: Weinzierl et al., 2002, Mol. Microbiol. 45
• Total vector size (bp): 10784
• Vector type: Bacterial Expression, CRISPR ; Self-replicating in Ustilago maydis, conferring carboxin resistance
• Selectable markers: Carboxin resistance conferred by mutated ip gene

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: short U6 promoter
• Species: Ustilago maydis
• Insert Size (bp): 304
• Mutation: Truncated version of the U6 promoter comprising 304 bp compared to 826 bp in pCas9_sgRNA_0

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGCGGATAACAATTTCACACAGG
• 3′ sequencing primer: TGTAGCACACGACTCACATC

Gene/Insert 2

• Gene/Insert name: cas9
• Species: Synthetic
• Insert Size (bp): 5393
• Mutation: Streptococcus pyogenes gene codon-optimized for Ustilago maydis
• Promoter: U. maydis hsp70 promoter (Kronstad and Leong, 1989 Proc. Natl. Acad. Sci. USA 86)
• Tag / Fusion Protein:
  • N-terminal NLS, C-terminal HA-tag +NLS (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ACAGCGATCCTGCTATTCC
• 3′ sequencing primer: CAAGACCGGCAACAGGATTC

Gene/Insert 3

• Gene/Insert name: tnos terminator
• Species: Agrobacterium tumefaciens
• Insert Size (bp): 291

Resource Information

• Supplemental Documents:
  • pMS73.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry