Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMS73
(Plasmid #110629)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110629 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNEBUC
  • Backbone manufacturer
    Weinzierl et al., 2002, Mol. Microbiol. 45
  • Total vector size (bp) 10784
  • Vector type
    Bacterial Expression, CRISPR ; Self-replicating in Ustilago maydis, conferring carboxin resistance
  • Selectable markers
    Carboxin resistance conferred by mutated ip gene

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    short U6 promoter
  • Species
    Ustilago maydis
  • Insert Size (bp)
    304
  • Mutation
    Truncated version of the U6 promoter comprising 304 bp compared to 826 bp in pCas9_sgRNA_0

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer TGTAGCACACGACTCACATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    cas9
  • Species
    Synthetic
  • Insert Size (bp)
    5393
  • Mutation
    Streptococcus pyogenes gene codon-optimized for Ustilago maydis
  • Promoter U. maydis hsp70 promoter (Kronstad and Leong, 1989 Proc. Natl. Acad. Sci. USA 86)
  • Tag / Fusion Protein
    • N-terminal NLS, C-terminal HA-tag +NLS (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ACAGCGATCCTGCTATTCC
  • 3′ sequencing primer CAAGACCGGCAACAGGATTC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    tnos terminator
  • Species
    Agrobacterium tumefaciens
  • Insert Size (bp)
    291

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMS73 was a gift from Regine Kahmann (Addgene plasmid # 110629 ; http://n2t.net/addgene:110629 ; RRID:Addgene_110629)
  • For your References section:

    Comparative analyses of secreted proteins in plant pathogenic smut fungi and related basidiomycetes. Schuster M, Schweizer G, Kahmann R. Fungal Genet Biol. 2018 Mar;112:21-30. doi: 10.1016/j.fgb.2016.12.003. Epub 2017 Jan 6. 10.1016/j.fgb.2016.12.003 PubMed 28089076