pSET-dCas9
(Plasmid
#110183)
-
PurposeExpression of the dCas9 gene in Streptomyces
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSET152
- Backbone size w/o insert (bp) 5715
- Total vector size (bp) 10158
-
Vector typeBacterial Expression, CRISPR ; i
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9
-
SpeciesSynthetic; artificially synthesized, codon optimized gene from S. pyogenes
-
Insert Size (bp)4107
-
MutationD10A, H840A
- Promoter ermE*p
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site EcoRV (unknown if destroyed)
- 5′ sequencing primer pSET152-F (GATGTAGGAGGGCGTGGATATG)
- 3′ sequencing primer pSET152-R (CCCAATACGCAAACCGCCTC) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSET-dCas9 was a gift from Yinhua Lu (Addgene plasmid # 110183 ; http://n2t.net/addgene:110183 ; RRID:Addgene_110183) -
For your References section:
CRISPR/dCas9-Mediated Multiplex Gene Repression in Streptomyces. Zhao Y, Li L, Zheng G, Jiang W, Deng Z, Wang Z, Lu Y. Biotechnol J. 2018 Jun 3. doi: 10.1002/biot.201800121. 10.1002/biot.201800121 PubMed 29862648