-
Purpose(Empty Backbone) pX330 (Plasmid #42230) with the N692A, M694A, Q695A, and H698A mutations
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108302 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerDr. Feng Zhang's Lab
- Backbone size (bp) 8506
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-HypaCas9 was a gift from Yuichiro Miyaoka (Addgene plasmid # 108302 ; http://n2t.net/addgene:108302 ; RRID:Addgene_108302) -
For your References section:
Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair. Kato-Inui T, Takahashi G, Hsu S, Miyaoka Y. Nucleic Acids Res. 2018 May 18;46(9):4677-4688. doi: 10.1093/nar/gky264. 10.1093/nar/gky264 PubMed 29672770
