pAAV-EF1α1.1-FLEX-rc [Jaws-KGC-GFP-ER2]
(Plasmid #108274)

• Purpose: AAV-mediated expression of Jaws-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.
• Depositing Lab: Edward Boyden
• Publication: Chuong et al Nat Neurosci. 2014 Aug;17(8):1123-9. doi: 10.1038/nn.3752. Epub 2014 Jul 6.

Backbone

• Vector backbone: pAAV-EF1α1.1-FLEX
• Backbone manufacturer: original from Stratagene
• Backbone size w/o insert (bp): 5375
• Total vector size (bp): 7028
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Jaws-KGC-GFP-ER2
• Alt name: Jaws
• Alt name: Halo57-KGC-GFP-ER2
• Alt name: K200R W214F
• Species: Haloarcula salinarum (stain Shark)
• Insert Size (bp): 1653
• Mutation: K200R W214F
• GenBank ID: KM000926.1
• Promoter: EF1α promoter (1.1kb short version)
• Tags / Fusion Proteins:
  • KGC (C terminal on insert)
  • GFP (C terminal on insert)
  • ER2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ggatcttggttcattctcaag
• 3′ sequencing primer: aaagagacagcaaccagg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.