pBAD-Ag43
(Plasmid #107743)

• Purpose: Expresses Ag43 under the control of an L-arabinose transcriptional regulator
• Depositing Lab: Ingmar Riedel-Kruse
• Publication: Jin et al Proc Natl Acad Sci U S A. 2018 Apr 3;115(14):3698-3703. doi: 10.1073/pnas.1720676115. Epub 2018 Mar 19.

Backbone

• Vector backbone: BBa_I0500-pSB4A3
• Backbone manufacturer: iGEM BioBricks
• Backbone size w/o insert (bp): 4549
• Total vector size (bp): 7833
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ag43
• Alt name: flu
• Insert Size (bp): 3284
• Mutation: removed all pstI cut sites with silent mutations, added RBS and terminator
• Entrez Gene: flu (a.k.a. b2000, ECK1993, agn, agn43, yeeQ, yzzX)
• Promoter: pBAD

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (destroyed during cloning)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: attaccgcctttgagtgagc
• 3′ sequencing primer: GCGGTCGGTCGATAAAAAAATCG

Resource Information

• Supplemental Documents:
  • pBAD-Ag43.gb
• A portion of this plasmid was derived from a plasmid made by: iGEM BioBricks BBa_K346007
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Ag43 contains a G981S variant compared to the NCBI reference (WP_000820410.1); plasmid functions as described in the associated publication.