Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBAD-Ag43
(Plasmid #107743)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107743 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    BBa_I0500-pSB4A3
  • Backbone manufacturer
    iGEM BioBricks
  • Backbone size w/o insert (bp) 4549
  • Total vector size (bp) 7833
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ag43
  • Alt name
    flu
  • Insert Size (bp)
    3284
  • Mutation
    removed all pstI cut sites with silent mutations, added RBS and terminator
  • Entrez Gene
    flu (a.k.a. b2000, ECK1993, agn, agn43, yeeQ, yzzX)
  • Promoter pBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer attaccgcctttgagtgagc
  • 3′ sequencing primer GCGGTCGGTCGATAAAAAAATCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    iGEM BioBricks BBa_K346007
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Ag43 contains a G981S variant compared to the NCBI reference (WP_000820410.1); plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-Ag43 was a gift from Ingmar Riedel-Kruse (Addgene plasmid # 107743 ; http://n2t.net/addgene:107743 ; RRID:Addgene_107743)
  • For your References section:

    Biofilm Lithography enables high-resolution cell patterning via optogenetic adhesin expression. Jin X, Riedel-Kruse IH. Proc Natl Acad Sci U S A. 2018 Apr 3;115(14):3698-3703. doi: 10.1073/pnas.1720676115. Epub 2018 Mar 19. 10.1073/pnas.1720676115 PubMed 29555779