AAV_CWSL.hSyn.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3
(Plasmid #107737)

• Purpose: In the presence of Cre, drives neuron-specific expression of both GCaMP6s fused to the presynaptic protein synaptophysin and independently the red-fluorescent protein mRuby3.
• Depositing Lab: Rylan Larsen
• Publication: AAV GCaMP6 Plasmids (unpublished)

Backbone

• Vector backbone: pAAV-CW3SL-EGFP
• Backbone manufacturer: Bong-Kiun Kaang
• Backbone size w/o insert (bp): 4476
• Total vector size (bp): 7252
• Modifications to backbone: A fragment containing the hSyn promoter, LoxP/Lox2272, and reverse-complemented Synaptophysin-GCaMP6s.P2A.mRuby3 was swapped into replace EGFP and the shortened CamKII promoter in the CW3SL backbone. Total AAV packaging size (including ITRs and DNA in between) is 4656 bp.
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: synaptophysin-GCaMP6s, mRuby3
• Alt name: synaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
• Alt name: mRuby3
• Species: R. norvegicus (rat); A. victoria (jellyfish)
• Insert Size (bp): 3913
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstAPI (not destroyed)
• 3′ cloning site: SrfI (not destroyed)
• 5′ sequencing primer: GGCCGCAGATGGGGGGGATG
• 3′ sequencing primer: ATCCAGAGGTTGATTATCTC

Resource Information

• Supplemental Documents:
  • CWSL_hSyn_DIO_synGCaMP6s_P2A_mRuby3_.gb
  • Restriction Digest - SmaI
• A portion of this plasmid was derived from a plasmid made by: Sequences were produced de novo based on published sequences. GCaMP6s based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258. The Synaptophysin-GCaMP6s fusion sequence was previously published by Ofer Yizhar's lab in Mahn et al, 2016 PMID: 26950004. mRuby3 sequence synthesis was based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains a naturally-occurring a G→T mutation in one of the AAV ITRs at position 570bp. However, we have still obtained high titer AAV using this plasmid and robust in vivo expression in Cre+ mouse neurons.