Skip to main content
Addgene

AAV_CWSL.nEF.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3
(Plasmid #107736)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107736 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CW3SL-EGFP
  • Backbone manufacturer
    Bong-Kiun Kaang
  • Backbone size w/o insert (bp) 3372
  • Total vector size (bp) 7305
  • Modifications to backbone
    A fragment containing the nEF promoter, LoxP/Lox2272, and reverse-complemented Synaptophysin-GCaMP6s.P2A.mRuby3 was swapped into replace EGFP and the shortened CamKII promoter in the CW3SL backbone. Total AAV packaging size (including ITRs and DNA in between) is 4681 bp.
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    synaptophysin-GCaMP6s, mRuby3
  • Alt name
    synaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Alt name
    mRuby3
  • Species
    R. norvegicus (rat); A. victoria (jellyfish)
  • GenBank ID
    24804
  • Promoter nEF

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pci (not destroyed)
  • 3′ cloning site SciI (destroyed during cloning)
  • 5′ sequencing primer CCTGGCCTTTTGCTGGCCTTTTGC
  • 3′ sequencing primer ATCCAGAGGTTGATTATCTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258. The Synaptophysin-GCaMP6s fusion sequence was previously published by Ofer Yizhar's lab in Mahn et al, 2016 PMID: 26950004. mRuby3 sequence synthesis was based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_CWSL.nEF.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3 was a gift from Rylan Larsen (Addgene plasmid # 107736 ; http://n2t.net/addgene:107736 ; RRID:Addgene_107736)