Skip to main content
Addgene

pTU1-A-pdh_RiboJ_GFP+_MGApt_Bba_B0015
(Plasmid #107576)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107576 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTU1-A - EcoFlex (Moore et al, 2016 - PubMed PMID: 27096716)
  • Backbone manufacturer
    N/A
  • Backbone size w/o insert (bp) 6148
  • Total vector size (bp) 6886
  • Modifications to backbone
    EcoFlex backbone (AmpR + pMB1) and Bacillus origin of replication (rebM) and tetracycline resistance (tetA)
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    50 ug/ml ampicillin in E. coli 5 ug/ml tetracycline in Bacillus
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP+
  • Alt name
    GFPuv3
  • Species
    Synthetic
  • Insert Size (bp)
    738
  • Mutation
    F64L/ S65T/ Q80R/ F99S/ M153T/ V163A
  • Promoter pdh promoter Bacillus megaterium DSM319
  • Tag / Fusion Protein
    • B. megaterium DSM319 xylA leader sequence (MTSSKIW) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site See Moore et al, 2016 - PubMed PMID: 27096716 (destroyed during cloning)
  • 3′ cloning site EcoFlex assembly (destroyed during cloning)
  • 5′ sequencing primer BM_VF; gctttcgctaaggatgatttctg
  • 3′ sequencing primer BM_VR; cgaaagggcctcgtgatac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTU1-A-pdh_RiboJ_GFP+_MGApt_Bba_B0015 was a gift from Paul Freemont (Addgene plasmid # 107576 ; http://n2t.net/addgene:107576 ; RRID:Addgene_107576)
  • For your References section:

    Rapid acquisition and model-based analysis of cell-free transcription-translation reactions from nonmodel bacteria. Moore SJ, MacDonald JT, Wienecke S, Ishwarbhai A, Tsipa A, Aw R, Kylilis N, Bell DJ, McClymont DW, Jensen K, Polizzi KM, Biedendieck R, Freemont PS. Proc Natl Acad Sci U S A. 2018 Apr 17. pii: 1715806115. doi: 10.1073/pnas.1715806115. 10.1073/pnas.1715806115 PubMed 29666238