hygII-UT-ABAleon2.1
(Plasmid
#106982)
-
PurposeABAleon2.1 in plant expression vector (Hygromycin resistance)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonehygII-UT
- Total vector size (bp) 15280
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameABAleon2.1
-
SpeciesSynthetic
-
Insert Size (bp)3057
- Promoter UBQ10
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Spe I/Xba I (destroyed during cloning)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer gctttctctttgcgcttgcg
- 3′ sequencing primer ggagtcacgttatgac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hygII-UT-ABAleon2.1 was a gift from Julian Schroeder (Addgene plasmid # 106982 ; http://n2t.net/addgene:106982 ; RRID:Addgene_106982) -
For your References section:
FRET-based reporters for the direct visualization of abscisic acid concentration changes and distribution in Arabidopsis. Waadt R, Hitomi K, Nishimura N, Hitomi C, Adams SR, Getzoff ED, Schroeder JI. Elife. 2014 Apr 15;3:e01739. doi: 10.7554/eLife.01739. 10.7554/eLife.01739 PubMed 24737861