Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRAB18-GFP
(Plasmid #106984)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 106984 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBI101
  • Total vector size (bp) 14231
  • Vector type
    Plant Expression
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sGFP
  • Promoter RAB18

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer cagctatgaccatgattacgcc
  • 3′ sequencing primer gacgttgtaaaacgacggccagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRAB18-GFP was a gift from Julian Schroeder (Addgene plasmid # 106984 ; http://n2t.net/addgene:106984 ; RRID:Addgene_106984)
  • For your References section:

    Chemical genetics reveals negative regulation of abscisic acid signaling by a plant immune response pathway. Kim TH, Hauser F, Ha T, Xue S, Bohmer M, Nishimura N, Munemasa S, Hubbard K, Peine N, Lee BH, Lee S, Robert N, Parker JE, Schroeder JI. Curr Biol. 2011 Jun 7;21(11):990-7. doi: 10.1016/j.cub.2011.04.045. Epub 2011 May 27. 10.1016/j.cub.2011.04.045 PubMed 21620700