pMKO.1 puro p53 shRNA 2
(Plasmid #10672)

• Depositing Lab: William Hahn
• Publication: Masutomi et al Cell. 2003 Jul 25. 114(2):241-53.

Backbone

• Vector backbone: pMKO.1
• Backbone size w/o insert (bp): 6700
• Vector type: Mammalian Expression, Retroviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: p53 shRNA
• Alt name: p53
• gRNA/shRNA sequence: GACTCCAGTGGTAATCTACT
• Species: H. sapiens (human)
• Insert Size (bp): 58
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pLXSN 5'
• 3′ sequencing primer: pBABE-3

Resource Information

• Articles Citing this Plasmid:
  • 13 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Also reference: Stewart, S.A., Dykxhoorn, D.M., Palliser, D., Mizuno, H., Yu, E.Y., Eisen, H.N., Sabatini, D.M., Hahn, W.C., Sharp, P.A., Weinberg, R.A., et al. (2003). RNA 9, 493