-
PurposeA version of the CROP-seq plasmid as presented in Datlinger et al. that contains the sgRNA-(F+E)-combined optimized backbone for CRISPRi from Chen et al.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonelentiGuide-puro
-
Backbone manufacturerFeng Zhang Lab
- Total vector size (bp) 10214
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a-Puro-WPRE-hU6-gRNA
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGGGCACTGACAATTCCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROP-seq-opti was a gift from Jay Shendure (Addgene plasmid # 106280 ; http://n2t.net/addgene:106280 ; RRID:Addgene_106280) -
For your References section:
On the design of CRISPR-based single-cell molecular screens. Hill AJ, McFaline-Figueroa JL, Starita LM, Gasperini MJ, Matreyek KA, Packer J, Jackson D, Shendure J, Trapnell C. Nat Methods. 2018 Feb 19. pii: nmeth.4604. doi: 10.1038/nmeth.4604. 10.1038/nmeth.4604 PubMed 29457792
Map uploaded by the depositor.
