pT7-7 asyn WT1-106 Mxe
(Plasmid
#105746)
-
PurposeBacterial expression of mutant human alpha synuclein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepT7-7
- Backbone size w/o insert (bp) 2438
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namealpha-synuclein 1-106 Mxe
-
SpeciesH. sapiens (human)
-
Mutation1-106AA Mxe
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (TAATACGACTCACTATAGG)
- 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-7 asyn WT1-106 Mxe was a gift from Hilal Lashuel (Addgene plasmid # 105746 ; http://n2t.net/addgene:105746 ; RRID:Addgene_105746)