pRVL-4
(Plasmid #104582)

• Purpose: Contains human kappa CL domain, for cloning of antibody VL domains using SapI restriction enzyme.
• Depositing Lab: Daniel Christ
• Publication: Vazquez-Lombardi et al Methods Mol Biol. 2018;1827:313-334. doi: 10.1007/978-1-4939-8648-4_16.

Backbone

• Vector backbone: pCEP4
• Backbone manufacturer: Invitrogen (Thermo Fisher)
• Backbone size w/o insert (bp): 10143
• Total vector size (bp): 10563
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 250 rpm
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human CL kappa
• Species: H. sapiens (human)
• Insert Size (bp): 420
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GAGGTCTATATAAGCAGAGC
• 3′ sequencing primer: GCTTATAATGGTTACAAATAAAGC

Resource Information

• Supplemental Documents:
  • pRVL-4
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS results found A227G, A230G, A232G, A258G, A295G, A297G, and A300G within the EBNA1 translation on the pCEP4 backbone compared to YP_401677.1