Skip to main content

pRVL-3
(Plasmid #104581)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104581 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCEP4
  • Backbone manufacturer
    Invitrogen (Thermo Fisher)
  • Backbone size w/o insert (bp) 10143
  • Total vector size (bp) 11244
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    250 rpm
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mouse IgG2c CH1/CH2/CH3 (mutated, no effector functions)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1101
  • Mutation
    L234A/L235E/G237A and E318A/K320A/K322A
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer GCTTATAATGGTTACAAATAAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRVL-3 was a gift from Daniel Christ (Addgene plasmid # 104581 ; http://n2t.net/addgene:104581 ; RRID:Addgene_104581)
  • For your References section:

    Expression of IgG Monoclonals with Engineered Immune Effector Functions. Vazquez-Lombardi R, Nevoltris D, Rouet R, Christ D. Methods Mol Biol. 2018;1827:313-334. doi: 10.1007/978-1-4939-8648-4_16. 10.1007/978-1-4939-8648-4_16 PubMed 30196504