pRVL-1
(Plasmid #104579)

• Purpose: Contains mouse kappa CL domain, for cloning of antibody VL domains using SapI restriction enzyme.
• Depositing Lab: Daniel Christ
• Publication: Vazquez-Lombardi et al Methods Mol Biol. 2018;1827:313-334. doi: 10.1007/978-1-4939-8648-4_16.

Backbone

• Vector backbone: pCEP4
• Backbone manufacturer: Invitrogen (Thermo Fisher)
• Backbone size w/o insert (bp): 10143
• Total vector size (bp): 10557
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 250 rpm
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mouse CL kappa
• Species: M. musculus (mouse)
• Insert Size (bp): 414
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GAGGTCTATATAAGCAGAGC
• 3′ sequencing primer: GCTTATAATGGTTACAAATAAAGC

Resource Information

• Supplemental Documents:
  • pRVL-1

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry