pRS52
(Plasmid
#104334)
-
PurposeExpresses sfGFP from the OmpR regulated PompF promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSC101*
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB10b
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesuperfolder GFP
-
Alt namesfGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter PompF
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer tgccacctgacgtctaagaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS52 was a gift from Jeffrey Tabor (Addgene plasmid # 104334 ; http://n2t.net/addgene:104334 ; RRID:Addgene_104334) -
For your References section:
Phosphatase activity tunes two-component system sensor detection threshold. Landry BP, Palanki R, Dyulgyarov N, Hartsough LA, Tabor JJ. Nat Commun. 2018 Apr 12;9(1):1433. doi: 10.1038/s41467-018-03929-y. 10.1038/s41467-018-03929-y PubMed 29650958