pNB22
(Plasmid #103059)

• Purpose: medium copy plasmid (pBR322 backbone) expressing the unstable GFP variant GFP-OVA under control of the nitric oxide-inducible promoter hmpAp
• Depositing Lab: Dirk Bumann
• Publication: Burton et al Cell Host Microbe. 2014 Jan 15;15(1):72-83. doi: 10.1016/j.chom.2013.12.006.

Backbone

• Vector backbone: pBR322
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP-OVA
• Promoter: hmpAp
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (unknown if destroyed)
• 3′ cloning site: Xba 1 (unknown if destroyed)
• 5′ sequencing primer: pBR322ori-F GGGAAACGCCTGGTATCTTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A short ovalbumin epitope (amino acids 319–343) was fused to GFP (pGFP_OVA) to follow the immune response to the expressed antigen. (Bumann, 2001).