Skip to main content
Addgene

pAAV-synp-F-H2B-GCaMP6f
(Plasmid #102994)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102994 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    unknown
  • Total vector size (bp) 6502
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Although Stable strains are highly recommended, regular strains (eg, DH5alpha) can be used for better yield.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-GCaMP6f
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1662
  • Promoter human synapsin I promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer GTCGACTCCGGAATAACTTCGTA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-synp-F-H2B-GCaMP6f was a gift from David Cox (Addgene plasmid # 102994 ; http://n2t.net/addgene:102994 ; RRID:Addgene_102994)

  • For your References section:

    High-speed volumetric imaging of neuronal activity in freely moving rodents. Skocek O, Nobauer T, Weilguny L, Martinez Traub F, Xia CN, Molodtsov MI, Grama A, Yamagata M, Aharoni D, Cox DD, Golshani P, Vaziri A. Nat Methods. 2018 Jun;15(6):429-432. doi: 10.1038/s41592-018-0008-0. Epub 2018 May 7. 10.1038/s41592-018-0008-0 PubMed 29736000
Related items:
Commonly requested with: