Skip to main content
Addgene

pHCD1Dsol
(Plasmid #102955)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102955 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    BCMGSNeo
  • Backbone manufacturer
    Karasuyama, Kudo & Melchers, 1990
  • Backbone size w/o insert (bp) 14580
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human soluble CD1D cDNA
  • Alt name
    NM_001766
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    969
  • Mutation
    Lacks the transmembrane region
  • Entrez Gene
    CD1D (a.k.a. CD1A, R3, R3G1)
  • Promoter CMV
  • Tag / Fusion Protein
    • BirA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTTGTTGTGCTGTCTCATC
  • 3′ sequencing primer TGCACCTGAGGAGTGAATTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHCD1Dsol was a gift from Gennaro De Libero & Lucia Mori (Addgene plasmid # 102955 ; http://n2t.net/addgene:102955 ; RRID:Addgene_102955)

  • For your References section:

    Fine tuning by human CD1e of lipid-specific immune responses. Facciotti F, Cavallari M, Angenieux C, Garcia-Alles LF, Signorino-Gelo F, Angman L, Gilleron M, Prandi J, Puzo G, Panza L, Xia C, Wang PG, Dellabona P, Casorati G, Porcelli SA, de la Salle H, Mori L, De Libero G. Proc Natl Acad Sci U S A. 2011 Aug 23;108(34):14228-33. doi: 10.1073/pnas.1108809108. Epub 2011 Aug 15. 10.1073/pnas.1108809108 PubMed 21844346
Related items:
Commonly requested with: