-
PurposeExpresses the Reverse Transcriptase gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102787 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemodified pET21
- Total vector size (bp) 8230
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namereverse transcription xenopolymerase
-
Alt nameRTX
-
Insert Size (bp)2328
- Promoter T7 promoter + lac operator
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer gatctcgatcccgcgaaattaatacg
- 3′ sequencing primer gctcagcggtggcagc (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET_RTX was a gift from Andrew Ellington (Addgene plasmid # 102787 ; http://n2t.net/addgene:102787 ; RRID:Addgene_102787) -
For your References section:
Synthetic evolutionary origin of a proofreading reverse transcriptase. Ellefson JW, Gollihar J, Shroff R, Shivram H, Iyer VR, Ellington AD. Science. 2016 Jun 24;352(6293):1590-3. doi: 10.1126/science.aaf5409. 10.1126/science.aaf5409 PubMed 27339990