PB-SAM
(Plasmid #102559)

• Purpose: Piggybac transposon vector encoding dCAS9-VP64 and MS2-P65-HSF1 activator helper complex.
• Depositing Lab: Ying Liu
• Publication: Li et al Mol Ther Nucleic Acids. 2017 Sep 15;8:64-76. doi: 10.1016/j.omtn.2017.06.007. Epub 2017 Jun 15.

Backbone

• Vector backbone: piggybac
• Backbone size w/o insert (bp): 3902
• Total vector size (bp): 14443
• Vector type: Mammalian Expression, CRISPR ; piggybac transposon
• Selectable markers: Hygromycin, Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: MS2-P65-HSF1_T2A_Hygro
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2523
• Mutation: N55K in MS2
• Promoter: EF1A

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcacttgatgtaattctc
• 3′ sequencing primer: cgtaagttatgtaacgcg

Gene/Insert 2

• Gene/Insert name: dCAS9(D10A, N863A)-VP64_T2A_Blast
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 4875
• Mutation: D10A and N863A in Cas9
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctgctaaccatgttcatgcc
• 3′ sequencing primer: gcattacacgtcttgagc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: dCAS9-VP64 and MS2-P65-HSF1 cassettes are from Feng Zhang's lab (Addgene #61423 and #61425).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry