Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAH1 (lenti hLPL-FLAG)
(Plasmid #102448)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102448 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRL-cPPT-MCS-IRES-Puro
  • Backbone size w/o insert (bp) 8041
  • Total vector size (bp) 9591
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lipoprotein lipase
  • Alt name
    LPL
  • Species
    H. sapiens (human)
  • Entrez Gene
    LPL (a.k.a. HDLCQ11, LIPD)
  • Promoter CMV
  • Tags / Fusion Proteins
    • FLAG (C terminal on insert)
    • 6x His (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTGGGAGGTCTATATAAGCAGAGCTCG
  • 3′ sequencing primer CTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAH1 (lenti hLPL-FLAG) was a gift from Brandon Davies (Addgene plasmid # 102448 ; http://n2t.net/addgene:102448 ; RRID:Addgene_102448)
  • For your References section:

    Angiopoietin-like 4 Modifies the Interactions between Lipoprotein Lipase and Its Endothelial Cell Transporter GPIHBP1. Chi X, Shetty SK, Shows HW, Hjelmaas AJ, Malcolm EK, Davies BS. J Biol Chem. 2015 May 8;290(19):11865-77. doi: 10.1074/jbc.M114.623769. Epub 2015 Mar 25. 10.1074/jbc.M114.623769 PubMed 25809481