pVC-Ds-MCS-Ds
(Plasmid #102416)

• Purpose: (Empty Backbone) Empty vector with a multiple cloning site flanked by Ds integration elements
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Chong-Morrison et al Biol Open. 2023 Jun 15;12(6):bio059995. doi: 10.1242/bio.059995. Epub 2023 Jun 27.

Backbone

• Vector backbone: Unknown
• Backbone size (bp): 3567
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ATCCCGTACCGACCGTTATC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Authors listed below, via MTA dated 27th August 2012.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A. Emelyanov and S. Parinov. Mifepristone-inducible LexPR system to drive and control gene expression in transgenic zebrafish. Developmental Biology, 320(1):113– 121, 2008. ISSN 00121606. doi: 10.1016/j.ydbio.2008.04.042.

A. Emelyanov, Y. Gao, N. I. Naqvi, and S. Parinov. Trans-kingdom transposition of the maize Dissociation element. Genetics, 174(3):1095–1104, 2006. ISSN 00166731. doi: 10.1534/genetics.106.061184.

Please visit https://www.biorxiv.org/content/10.1101/450684v2 for bioRxiv preprint.