Skip to main content
Addgene

U6REST1_U6REST2.hPGK.BRN2.hPGK.Ascl1WPRE
(Plasmid #101852)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101852 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 5845
  • Total vector size (bp) 10279
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ascl1, Brn2
  • Alt name
    ASH1, HASH1, MASH1, bHLHa46; POU3F2, OCT7; OTF7; OTF-7; POUF3, oct-7; N-Oct3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4434
  • GenBank ID
    429 5454
  • Promoter U6, PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer tttcccatgattccttcata
  • 3′ sequencing primer catagttaagaataccag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6REST1_U6REST2.hPGK.BRN2.hPGK.Ascl1WPRE was a gift from Malin Parmar (Addgene plasmid # 101852 ; http://n2t.net/addgene:101852 ; RRID:Addgene_101852)

  • For your References section:

    REST suppression mediates neural conversion of adult human fibroblasts via microRNA-dependent and -independent pathways. Drouin-Ouellet J, Lau S, Brattas PL, Rylander Ottosson D, Pircs K, Grassi DA, Collins LM, Vuono R, Andersson Sjoland A, Westergren-Thorsson G, Graff C, Minthon L, Toresson H, Barker RA, Jakobsson J, Parmar M. EMBO Mol Med. 2017 Aug;9(8):1117-1131. doi: 10.15252/emmm.201607471. 10.15252/emmm.201607471 PubMed 28646119
Related items:
Commonly requested with: