pGL3-TGFb1
(Plasmid #101762)

• Purpose: TGFb1 promoter reporter
• Depositing Lab: Yuh-Shan Jou
• Publication: Yeh et al Nat Cell Biol. 2018 Apr;20(4):479-491. doi: 10.1038/s41556-018-0062-y. Epub 2018 Mar 28.

Backbone

• Vector backbone: pGL3
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 5661
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: transforming growth factor beta 1 promoter
• Alt name: TGFb1 promoter
• Species: H. sapiens (human)
• Insert Size (bp): 843
• Entrez Gene: TGFB1 (a.k.a. CED, DPD1, IBDIMDE, LAP, TGF-beta1, TGFB, TGFbeta)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Kpn1 (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: RVprimer3
• 3′ sequencing primer: CTAGCAAAATAGGCTGTCCC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry