pAAV hSyn1 CaRhGC wt T2A tDimer
(Plasmid #101720)

• Purpose: humanized, Neuron-specific promoter driven expression of the rhodopsin guanylyl cyclase from Catenaria anguillulae with a neuron-specific promoter. Useful for raising intracellular cAMP close to the m
• Depositing Lab: Thomas Oertner
• Publication: Scheib et al Nat Commun. 2018 May 24;9(1):2046. doi: 10.1038/s41467-018-04428-w.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4568
• Total vector size (bp): 7970
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CatRhGC
• Alt name: CaCyclOP
• Species: Cateneraria anguillulae
• Insert Size (bp): 1867
• Promoter: hSyn1

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: gactcagcgctgcctcagtctg
• 3′ sequencing primer: GGATTCTCCTCCACGTCACCGC

Gene/Insert 2

• Gene/Insert name: red fluorescent protein
• Alt name: tDimer2
• Species: Discoma sp.
• Insert Size (bp): 1395
• Promoter: ribosomal skip sequence T2A

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ggcagaggaagtcttctaacat
• 3′ sequencing primer: GTAATCCAGAGGTTGATTATCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: CatRhGC originally from P.Hegemann ,HU-Berlin Germany tDimer originally from R.Tsien, USD USA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry