eSpCas9(1.1)-T2A-Puro
(Plasmid #101039)

• Purpose: (Empty Backbone) Enhanced SpCas9(1.1) with puromycin resistance gene via T2A linker.
• Depositing Lab: Andrea Németh
• Publication: eSpCas9(1.1)-T2A-Puro (unpublished)

Backbone

• Vector backbone: eSpCas9(1.1)
• Backbone manufacturer: Feng Zhang lab
• Backbone size (bp): 8506
• Modifications to backbone: Addition of T2A linker and Puromycin Resistance
• Vector type: Mammalian Expression, CRISPR
• Promoter: CBh
• Selectable markers: Puromycin
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • T2A-Puro (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: eSpCas9(1.1) was a gift from Feng Zhang (Addgene plasmid # 71814)
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry