Skip to main content
Addgene

pcrDNA3.1-PRKACA
(Plasmid #100890)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100890 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCR3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6076
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Protein Kinase CAMP-Activated Catalytic Subunit Alpha
  • Alt name
    PRKACA
  • Alt name
    PKA C-Alpha
  • Species
    H. sapiens (human)
  • Mutation
    Isoform 1 wild type
  • GenBank ID
    NM_002730.3
  • Entrez Gene
    PRKACA (a.k.a. CAFD1, PKACA, PPNAD4)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert was artificially synthesized

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcrDNA3.1-PRKACA was a gift from Sanford Simon (Addgene plasmid # 100890 ; http://n2t.net/addgene:100890 ; RRID:Addgene_100890)

  • For your References section:

    Detection of a recurrent DNAJB1-PRKACA chimeric transcript in fibrolamellar hepatocellular carcinoma. Honeyman JN, Simon EP, Robine N, Chiaroni-Clarke R, Darcy DG, Lim II, Gleason CE, Murphy JM, Rosenberg BR, Teegan L, Takacs CN, Botero S, Belote R, Germer S, Emde AK, Vacic V, Bhanot U, LaQuaglia MP, Simon SM. Science. 2014 Feb 28;343(6174):1010-4. doi: 10.1126/science.1249484. 10.1126/science.1249484 PubMed 24578576
Related items:
Commonly requested with: