-
PurposeExpresses C-terminal V5-tagged BirA biotin ligase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF1a-V5-neo
- Backbone size w/o insert (bp) 6174
- Total vector size (bp) 7088
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameC-terminal V5-tagged BirA
-
SpeciesE. coli
-
Insert Size (bp)963
- Promoter Human EF1a
-
Tag
/ Fusion Protein
- V5, His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1a-BirA-V5-neo was a gift from Jian Xu (Addgene plasmid # 100548 ; http://n2t.net/addgene:100548 ; RRID:Addgene_100548) -
For your References section:
In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Liu X, Zhang Y, Chen Y, Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu J. Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003. 10.1016/j.cell.2017.08.003 PubMed 28841410