pcDNA-Flag-Kdm6b(1025-End)-pA
(Plasmid #100278)

• Purpose: In vitro transcription template (T7 promoter) for Kdm6b catalytic domain active form.
• Depositing Lab: Yi Zhang
• Publication: Inoue et al Nature. 2017 Jul 19. doi: 10.1038/nature23262.

Backbone

• Vector backbone: pcDNA3.1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kdm6b
• Alt name: Jmjd3
• Species: M. musculus (mouse)
• Mutation: catalytic domain (1025aa-End)
• Entrez Gene: Kdm6b (a.k.a. 1700064E03Rik, Jmjd3)
• Promoter: T7
• Tag / Fusion Protein:
  • Flag epitope tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CACTGCTTACTGGCTTATCG
• 3′ sequencing primer: CCAAACTTTTATTTGTGCACAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry