Skip to main content
Addgene

pAAV-U6sgp53-mTSG-GFAPCre
(Plasmid #100276)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100276 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFAP promoter
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Entrez Gene
    Gfap
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer aaagtggcaccgagtcggtgcTTTTTTtctagaagagggc
  • 3′ sequencing primer cccagcacagagagggaggtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that some sequence discrepancies were found between Addgene's quality control and the depositor's genbank sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6sgp53-mTSG-GFAPCre was a gift from Sidi Chen (Addgene plasmid # 100276 ; http://n2t.net/addgene:100276 ; RRID:Addgene_100276)
  • For your References section:

    AAV-mediated direct in vivo CRISPR screen identifies functional suppressors in glioblastoma. Chow RD, Guzman CD, Wang G, Schmidt F, Youngblood MW, Ye L, Errami Y, Dong MB, Martinez MA, Zhang S, Renauer P, Bilguvar K, Gunel M, Sharp PA, Zhang F, Platt RJ, Chen S. Nat Neurosci. 2017 Aug 14. doi: 10.1038/nn.4620. 10.1038/nn.4620 PubMed 28805815