pET26-CNTnw
(Plasmid
#100163)
-
Purposerecombinant expression of target protein as an MBP-His tag fusion at the N-terminus of target protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET26
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameConcentrative nucleoside transporter
-
Alt nameEGZ45206
-
SpeciesNeisseria wadsworthii
-
Insert Size (bp)1278
- Promoter T7
-
Tag
/ Fusion Protein
- MBP-His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CAGATGTCCGCTTTCTGGTATG
- 3′ sequencing primer T7_reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET26-CNTnw was a gift from Seok-Yong Lee (Addgene plasmid # 100163 ; http://n2t.net/addgene:100163 ; RRID:Addgene_100163) -
For your References section:
Visualizing multistep elevator-like transitions of a nucleoside transporter. Hirschi M, Johnson ZL, Lee SY. Nature. 2017 May 4;545(7652):66-70. doi: 10.1038/nature22057. Epub 2017 Apr 17. 10.1038/nature22057 PubMed 28424521