RUNX1
Description
RUNX family transcription factor 1
Also known as
AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha
Species
Homo sapiens
Entrez ID
861
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids containing this gene, or a homologous gene.
| ID | Plasmid | Gene/Insert | PI |
|---|---|---|---|
| 12426 | pCMV5-AML1B | AML1B (Homo sapiens) | Hiebert |
| 12428 | pCMV-AML1-ETO | AML1-ETO fusion (Homo sapiens) | Hiebert |
| 12429 | pUHD-AML1-ETO | AML1-ETO (Homo sapiens) | Zhang |
| 12430 | pUHD-HA-AML1-ETO | AML1-ETO (Homo sapiens) | Zhang |
| 12431 | MigR1-AE | AML1-ETO fusion (Homo sapiens) | Zhang |
| 12432 | MigR1-AEtr | C-term truncated AML1-ETO (Homo sapiens) | Zhang |
| 12433 | MigR1-AE9a | AML1-ETO9a fusion (Homo sapiens) | Zhang |
| 12434 | MigR1-AE9aP | AML1-ETO9a as in t(8;21) patients (Homo sapiens) | Zhang |
| 45816 | pLKO.1 shRUNX1 puro | Runx1 (Homo sapiens) | Janes |
| 53802 | Runx1_pCSdest | Runx1 (Homo sapiens) | Reeves |
| 60832 | MSCV-AML1/ETO-IRES-GFP | AML1/ETO (Homo sapiens) | Lowe |
| 97043 | pINDUCER-21-RUNX1 | Runt Related Transcription Factor 1 (Homo sapiens) | Daley |
| 120475 | EF1a_RUNX1_P2A_Hygro_Barcode | RUNX1 (Homo sapiens) | Mali |
| 139821 | pFUW-tetO-RUNX1 | Runx1 (Homo sapiens) | Pereira |
| 141887 | TFORF1919 | RUNX1 (Homo sapiens) | Zhang |
| 142887 | TFORF1920 | RUNX1 (Homo sapiens) | Zhang |
| 144949 | TFORF3473 | RUNX1 (Homo sapiens) | Zhang |
| 154089 | pINDUCER-21-RUNX1-P2A-ERG-IMPROVED | Runt Related Transcription Factor 1, ETS-Related Gene (Homo sapiens) | Daley |
| 176974 | RUNX1_pcDNA6.2/EmGFP-Bsd | RUNX1 (Homo sapiens) | Reeves |
| 181976 | pLeGO.sgGata1.4.RUNX1A.iG2 | GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) | Klusmann |
| 181977 | SIN40C.TRE.HA.RUNX1A.IRES.dTomato.PGK.sfGFP.P2A.Tet3G | RUNX1A (human) (Homo sapiens) | Klusmann |
| 181978 | SIN40C.TRE.HA.RUNX1C.IRES.dTomato.PGK.sfGFP.P2A.Tet3G | RUNX1C (human) (Homo sapiens) | Klusmann |
| 181979 | pRRL.PPT.SFFV.HA.RUNX1A.IRES.eGFP | RUNX1A (human) (Homo sapiens) | Klusmann |
| 181980 | pRRL.PPT.SFFV.HA.RUNX1C.IRES.eGFP | RUNX1C (human) (Homo sapiens) | Klusmann |
| 192928 | pPB-cT3G-cERP2-RUNX1 | RUNX1 (Homo sapiens) | Church |
| 194574 | pRK5-mEGFP-RUNX1-WT | RUNX1 (Homo sapiens) | Hnisz |
| 194575 | pRK5-mEGFP-RUNX1-MUT | RUNX1 (Homo sapiens) | Hnisz |
| 200500 | pKLV2-U6gRNA5(RUNX1(11))-PGKpuro2ABFP-W | RUNX1(11) (Homo sapiens) | Yusa |
| 200501 | pKLV2-U6gRNA5(RUNX1(13))-PGKpuro2ABFP-W | RUNX1(13) (Homo sapiens) | Yusa |
| 205818 | CL20_mEGFP_ETV6_RUNX1 | ETV6_RUNX1 (Homo sapiens) | Kriwacki |
| 205914 | CL20_mEGFP_RUNX1_CBFA2T3 | RUNX1_CBFA2T3 (Homo sapiens) | Kriwacki |
| 205915 | CL20_mEGFP_RUNX1_RUNX1T1 | RUNX1_RUNX1T1 (Homo sapiens) | Kriwacki |
| 208569 | pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-W | RUNX1(13), RUNX3(12) (Homo sapiens) | Yusa |
| 208570 | pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(13))-PGKpuroBFP-W | RUNX1(13), RUNX3(13) (Homo sapiens) | Yusa |